| Strain | 20002 |
|---|---|
| Classification | Pleosporales, Sporormiaceae, Preussia |
| Culture collection | processing |
| Detection frequency | Low |
| Figure |  Fig. 1 5-day-old colony on PDA  Fig. 2 Preussia sp. 20002. a. Ascomata (indicated by black arrow) and Phoma-like anamorph (indicated by white arrow) on OA. b, c. Ascomata. d. Ascomal wall. e, f. Asci and ascospores. g, h. Conidiomata. i. Conidia(Bars= 5 μm, unless otherwise specified) |
| Colonies | Colonies on PDA attaining 19-mm at 25 °C after 5 days, cottony, white, margin irregular, turning olivaceous brown and wrinkled with age, reverse initially white, turning grey with age, occasionally with yellow diffusing pigment. |
| Pycnidia | Pycnidia abundant on OA after 7 days, superfical, globose, with inconspicuous ostiole, up to 100 µm in diam. |
| Conidia | Conidia hyaline, ellipsoidal to ovoid, 1-guttulate,.2.0–3.0 × 1.5–2.0 µm. |
| Ascomata | Pseudothecia sparsely produced on OA after 14 days, dark brown, globose to subglobose, up to 400 µm in diam. |
| Asci | Asci clavate, bitunicate, mostly 8-spored, occasionally less, 150–220 × 16–25 µm. |
| Ascospores | Ascospores 4-celled, fusiform, dark brown when mature; end cells conical with a straight germ silt, 9–13 × 6.5–8.5 µm; middle cells cylindrical with a curved or sigmoidal germ silt, 7.5–11 × 7.5–9.5 µm. |
| Note | Based on the BLAST result of the ITS sequence, the strain 20002 shares 97.72% identity with Preussia cymatomera strain CBS 396.81 (KX710252).
The genus Preussia is closely related to Sporormiella. Both are characterized by ≥4-celled ascospores with germ silts. Recent research has found that there are many exceptions to substrate preferences and the presence of ostiole which used to distinguish these two genera, and these taxonomic characters are also not supported by phylogenetic analyses. Therefore, these two genera may be synonyms (Gonzalez-Menendez et al., 2017; Kruys & Wedin, 2009). |
| Pathogenicity | Unknown |
| Specimens examined | Taiwan, Tainan City, rice grains (cultivar Tainan sen No.18), Aug 2019, Lee, Yi Chen, 20002 Taiwan, Taitung County, rice grains (cultivar Kaohsiung 139), Aug 2013, Jie-Hao Ou, 13056 |
| ITS | GGCCCTGTCGTGATAGAACCCTTGCCTTTTGAGTACCGTCCGTTTCCTCGGCAGGCTCGCCTGCCAATGGGGACCCCCAATAAACCCTTTTTATGTACCTGTATCAGTCTGACAAACAAACAAAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATTTGTAACCTCAAGCTCAGCTTGGTGTTGGGTGTCTGTCCCCGCCCCGCGCGGGGACTCGCCTCAAAAACATTGGCGGCCGGTACGTTGGCTTCGAGCGCAGCAGAAACGCGAACTCGAGGCCCGACGGATCGGCGACCAGAAGTCACTTCTTCCACAGCTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA |