Nemania sp. 15008

Strain 15008
Classification Xylariales, Xylariaceae, Nemania
Culture collection BCRC FU31271
Detection frequency Low
Figure Fig. 1 5-day-old colony on PDA Fig. 2 Nemania sp. 15008. a–d, f. Conidiophores and conidia. e. Conidia (Bars= 5 μm, unless otherwise specified)
Colonies Colonies on PDA attaining 17-mm at 25 °C after 5 days, velvety or powdery, greyish brown, margin entire, reverse dark brown.
Conidiophores Conidiophores macronematous erect, simple or branched, hyaline, turning brown with age.
Conidiogenous cells Conidiogenous cells integrated, terminal or intercalary, sympodial, with zigzag-shaped and denticulate conidiogenous loci.
Conidia Conidia hyaline, ellipsoidal, straight or slightly curved, with slightly truncated base, 5–7(–10) × 2.0–3.0(–3.5) µm.
Note The Nemania species are commonly found on dead wood, appearing as pulvinate stromata. The similarity between the sequence of strain 15008 and the sequences of Nemania bipapillata, strain N111M (Tang et al., 2009) and HAST 90080610 (Wendt et al., 2018), in ITS region, was 99.76% (AJ390429) and 85.81% (GU292818) respectively. Because most Nemania species lack sequences from type materials, reliable identification cannot be achieved by sequence analysis alone.
Morphologically, asexual morph of Strain 15008 has a proliferating geniculate conidiogenous cells, which is in line with Geniculosporium state of Nemania . The placement of this strain in Nemania is undoubted. The species identity is uncertain.
Pathogenicity Unknown
Specimens examined Taiwan, Kaohsiung City, rice grains, Jan 2014, Jie-Hao Ou, 15008
ITS GGCTGCGGGGTGGCCCTGCCGGCGGCCCACGAAACTCTTGTCTAGCACTGAATTCTGAGCCCGAGAGGGATAAAAAACAAAATTAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAAACCCTCAAGCCTCGTTGCTTGGTGTTGGGAGCCTACGGCTGTAGCTCCTCAAAGTCAGTGGCGTGGGCTGGCTCGCACCCCAGATGTAGTAGTTATTTCTCTCACCTGTGGTCGGGCTAGTCCCCTGCCGTAAAACCCCCCAGACTTTTTAGTGTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA
LSU AAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCT