| Strain | 15008 |
|---|---|
| Classification | Xylariales, Xylariaceae, Nemania |
| Culture collection | BCRC FU31271 |
| Detection frequency | Low |
| Figure | Fig. 1 5-day-old colony on PDA Fig. 2 Nemania sp. 15008. a–d, f. Conidiophores and conidia. e. Conidia (Bars= 5 μm, unless otherwise specified) |
| Colonies | Colonies on PDA attaining 17-mm at 25 °C after 5 days, velvety or powdery, greyish brown, margin entire, reverse dark brown. |
| Conidiophores | Conidiophores macronematous erect, simple or branched, hyaline, turning brown with age. |
| Conidiogenous cells | Conidiogenous cells integrated, terminal or intercalary, sympodial, with zigzag-shaped and denticulate conidiogenous loci. |
| Conidia | Conidia hyaline, ellipsoidal, straight or slightly curved, with slightly truncated base, 5–7(–10) × 2.0–3.0(–3.5) µm. |
| Note | The Nemania species are commonly found on dead wood, appearing as pulvinate stromata. The similarity between the sequence of strain 15008 and the sequences of Nemania bipapillata, strain N111M (Tang et al., 2009) and HAST 90080610 (Wendt et al., 2018), in ITS region, was 99.76% (AJ390429) and 85.81% (GU292818) respectively. Because most Nemania species lack sequences from type materials, reliable identification cannot be achieved by sequence analysis alone.
Morphologically, asexual morph of Strain 15008 has a proliferating geniculate conidiogenous cells, which is in line with Geniculosporium state of Nemania . The placement of this strain in Nemania is undoubted. The species identity is uncertain. |
| Pathogenicity | Unknown |
| Specimens examined | Taiwan, Kaohsiung City, rice grains, Jan 2014, Jie-Hao Ou, 15008 |
| ITS | GGCTGCGGGGTGGCCCTGCCGGCGGCCCACGAAACTCTTGTCTAGCACTGAATTCTGAGCCCGAGAGGGATAAAAAACAAAATTAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAAACCCTCAAGCCTCGTTGCTTGGTGTTGGGAGCCTACGGCTGTAGCTCCTCAAAGTCAGTGGCGTGGGCTGGCTCGCACCCCAGATGTAGTAGTTATTTCTCTCACCTGTGGTCGGGCTAGTCCCCTGCCGTAAAACCCCCCAGACTTTTTAGTGTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA |
| LSU | AAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAATGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCT |
Fig. 1 5-day-old colony on PDA
Fig. 2 Nemania sp. 15008. a–d, f. Conidiophores and conidia. e. Conidia (Bars= 5 μm, unless otherwise specified)