| Strain | 14161 |
|---|---|
| Classification | Diaporthales, Diaporthaceae, Diaporthe |
| Culture collection | processing |
| Detection frequency | Low |
| Figure |  Fig. 1 5-day-old colony on PDA  Fig. 2 Diaporthe aff. tectonendophytica. a, b. Conidiophores, conidiogenous cells and conidia. c. Conidia. d. Conidiomata on PDA (Bars= 5 μm, unless otherwise specified) |
| Colonies | Colonies on PDA attaining 74-mm at 25 °C after 5 days, margins entire, velvety, initially white, azonate, turning pale brown from the center, reverse similar. |
| Conidiophores | Conidiophores hyaline, branched, cylindrical, arise from swollen pigmented cells. |
| Conidiogenous cells | Conidiogenous cells phialidic, cylindrical to conical, hyaline, tapering toward the apex, 9–14(–20) × 2–4(–5) µm. |
| Conidia | Alpha conidia not observed. Beta conidia hyaline, filiform, curved, cream-yellow in mass, 19-30(–35) × 1–1.5(–2) µm. |
| Note | Based on ITS sequence, it is closely related to D. tectonendophytica MFLUCC 13-0471 (98.99%). Strain 14161 conformed to the description of D. tectonendophytica by Doilom et al. (2017) in the Beta conidia, but differed in the lack of alpha conidia. The colony morphology was “lobate with concentric rings of dense and sparse hyphae, irregular margin” in D. tectonendophytica (Doilom et al., 2017) on the PDA. However, strain 14161 has colony of "margins entire, velvety, azonate". |
| Pathogenicity | Unknown |
| Specimens examined | Taiwan, Taitung County, rice grains (cultivar Kaohsiung 139), Nov 2014, Jie-Hao Ou, 14161 Taiwan, Ilan County, rice grains, Feb 2017, Jie-Hao Ou, 17033 |
| ITS | GCGCACCCAGAAACCCTTTGTGAACTTATACCTACTGTTGCCTCGGCGCAGGCCGGCTTCTTCACTGAGGCCCCCTGGAGACAGGGAGCAGCCCGCCGGCGGCCAACTAAACTCTTGTTTCTTAGTGAATCTCTGAGTAAAAACATAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGATGGGGCACTGCTCTCTAGCGGGAGCAGGCCCTGAAATCTAGTGGCGAGCTCGCCAGGACCCCGAGCGTAGTAGTTATATCTCGTTCTGGAAGGCCCTGGCGGTGCCCTGCCGTTAAACCCCCAACTTCTGAAAATTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA |