| Authors | (Ehrenb.) Rehm 1904 |
|---|---|
| Strain | 14154 |
| Classification | Xylariales, Hypoxylaceae, Daldinia |
| Culture collection | BCRC FU31266 |
| Detection frequency | Medium |
| Figure |  Fig. 1 5-day-old colony on PDA  Fig. 2 Daldinia eschscholtzii. a–d. Conidiophores and conidia. e. Conidia (Bars= 5 μm, unless otherwise specified) |
| Colonies | Colonies on PDA attaining 80-mm at 25 °C after 5 days, margins entire, cottony, reverse initially white, becoming olivaceous brown with age. |
| Conidiophores | Conidiophores macronematous, erect, hyaline to pale brown, rough-walled, often with 1–3 short lateral branches, terminating in 1–3(–4) conidiogenous cells in whorls. |
| Conidiogenous cells | Conidiogenous cells cylindrical, hyaline, mostly terminal, rarely intercalary, slightly denticulate near the conidiogenous loci, 9–15(–20) × 2.5–3.5 µm. |
| Conidia | Conidia one-celled, smooth, hyaline, obovoid, with a slightly truncated base, 4.5–7 × 2–3 µm. |
| Note | This species is known for the obvious teleomorphic stromata occurring on wood. The strain obtained from rice seed is anamorphic, and its morphological characteristics are consistent with the description of anamorphic Daldinia eschscholtzii observed in culture by Stadler et al. (2014).
Even though the strain 14154 has slight difference from Daldinia eschscholtzii CALP 11206 (epitype) in the ITS sequence (98.06%), the assignment of this strain to Daldinia eschscholtzii is adequate. This strains was nested within strains of Daldinia eschscholtzii approved by Stadler et al. (2014) in phylogenetic analysis. |
| Pathogenicity | Unknown. This species is generally considered as endophyte. |
| Specimens examined | Taiwan, Taitung County, rice grains (cultivar Taitung 30), Oct 2014, Jie-Hao Ou, 14145 Taiwan, Taitung County, rice grains (cultivar Kaohsiung 139), Nov 2014, Jie-Hao Ou, 14154 Taiwan, Taichung City, rice grains (cultivar Taichung 194), Dec 2014, Jie-Hao Ou, 14170 |
| ITS | ACTCCAACCCTATGTGAACTTACCGCCGTTGCCTCGGCGGGCCGCGTTCGCCCTGTAGTTTACTACCTGGCGGCGCGCTACAGGCCCGCCGGTGGACTGCTAAACTCTGTTATATATACGTATCTCTGAATGCTTCAACTTAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCCCTGTTGCTTAGCGTTGGGAATCTAGGTCTCCAGGGCCTAGTTCCCCAAAGTCATCGGCGGAGTCGGAGCGTACTCTCAGCGTAGTAATACCATTCTCGCTTTTGCAGTAGCCCCGGCGGCTTGCCGTAAAACCCCTATATCTTTAGTGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAA |