Albifimbria verrucaria
| Authors |
(Alb. & Schwein.) L. Lombard & Crous 2016 |
| Strain |
13054 |
| Classification |
Hypocreales, Stachybotryaceae, Albifimbria |
| Culture collection |
BCRC FU30211 |
| Detection frequency |
Low |
| Accession number |
LC494380 |
| Figure |
 Fig. 1 5-day-old colony on PDA  Fig. 2 Albifimbria verrucaria. a.Sporulation on cornmeal agar. b, e. Phialidic conidiogenous cells. c, d.Conidia with inconspicuous fantailed appendages (Bars= 5 μm, unless otherwise specified).  Fig. 3 Necrosis on inoculated leaf. |
| Colonies |
Colonies on PDA attaining 19-, 20-, 0-mm diam. at 24 °C, 28 °C and 37 °C after 5 days, margins entire, cottony, reverse yellowish to pale orange, aerial mycelium scanty on CMA. |
| Conidiophores |
Conidiophores macronematous, branched, densely aggregated, forming sporodochia. |
| Conidiogenous cells |
Conidiogenous cells phialidic, subhyaline, discrete, cylindrical, 10–18 × 2–3 µm. |
| Conidia |
Conidia borne in slimy mass, pale brown, dark black in mass, broadly fusiform, sometimes guttulate, with inconspicuous fantailed appendages, 5.5–7.5 × 2.5–3.5 µm. |
| Note |
Strain 13054 shares 99.8% identity in ITS region with the ex-type strain of Albifimbria verrucaria (CBS 328.52, MH857060), with only difference in a single-nucleotide gap. |
| Pathogenicity |
This species have been reported to cause Myrothecium blotch on rice (Ou, 1985). Pathogenicity was confirmed by artificial inoculation with strain 13054. Leaf necrosis was observed on inoculated rice plant. |
| Specimens examined |
Taiwan, Taichung City, rice grains (cultivar Tainan 11), Sep 2013, Jie-Hao Ou, 13054 |
| ITS |
TTACAAACTCCCAAACCCTTTGTGAACCTTACCATATTGTTGCTTCGGCGGGACCGCCCCGGCGCCTTCGGGCCCGGAACCAGGCGCCCGCCGGAGGCCCCAAACTCTTATGTCTTTAGTGGTTTTCTCCTCTGAGTGACACATAAACAAATAAATAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAGGCCCCCAGTGCCTGGTGTTGGGGATCGGCCCAGCCTTCTCGCAAGGCCGCCGGCCCCGAAATCTAGTGGCGGTCTCGCTGTAGTCCTCCTCTGCGTAGTAGCACAACCTCGCAGTTGGAACGCGGCGGTGGCCATGCCGTTAAACACCCCACTTCTGAAAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA |